| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.074054 |
| Chromosome: | chromosome 16 |
| Location: | 7329388 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g678997 | (1 of 2) 2.4.2.38 - Glycoprotein 2-beta-D-xylosyltransferase / Beta-1,2-xylosyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCGCACGGCGCCCGGCCCCCACCTGCAGGCCCTGGTCCACCAGTCGC |
| Internal bar code: | CCTGGCTCGGGGCGGATTATCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 509 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATGTACCGTAGCTGCGCAG |
| Suggested primer 2: | CAGGAGCAAGAGGAGCACAA |