| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.074076 |
| Chromosome: | chromosome 2 |
| Location: | 2393452 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g091050 | ALAD1,PBGS,HEM2,ALAD | (1 of 1) 4.2.1.24 - Porphobilinogen synthase / Delta-aminolevulinic acid dehydratase; Delta-aminolevulinic acid dehydratase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGAACCGGTGTGCGGTGCTTCGGGCGGTGAGAGAGCGTGGATGATACG |
| Internal bar code: | GAACCCACTTGCGGCAGGGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 547 |
| LEAP-Seq percent confirming: | 8.88889 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCCCACAAAAGCACCAGC |
| Suggested primer 2: | AGACCTACCAGATGGACCCC |