| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.074128 |
| Chromosome: | chromosome 16 |
| Location: | 4923198 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686700 | (1 of 10) PTHR31867//PTHR31867:SF1 - FAMILY NOT NAMED // EXPANSIN-A1-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTGTGTCTTCTAAGGACATTCGACTCACCAGGCATCGGTGATGGTGAC |
| Internal bar code: | GATGTTGTAGGTGCGCTAATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 67 |
| LEAP-Seq percent confirming: | 4.28571 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 67 |
| LEAP-Seq n unique pos: | 70 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGTGGACGGGTAGAGGAT |
| Suggested primer 2: | GTACCGAATGCCAATGACGC |