| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.074137 |
| Chromosome: | chromosome 10 |
| Location: | 1970794 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g432050 | FAP284 | Flagellar Associated Protein 284; (1 of 2) PF15239 - Domain of unknown function (DUF4586) (DUF4586) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTAAACAATACACGACAAGGTGCACGCGTACCAGGTTTGGGCAACGGT |
| Internal bar code: | GATATATTGTCTACGCTTCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 845 |
| LEAP-Seq percent confirming: | 45.4545 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGCTGTGACCACATAGTT |
| Suggested primer 2: | ACACAGGGCTTACCGGAATG |