Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.074143 |
Chromosome: | plastome |
Location: | 132260 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802319 | 2717001,ChreCp055,rps11 | 30S ribosomal protein S11; (1 of 1) IPR019981 - Ribosomal protein S11, bacterial-type | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGGTGGCCTGCTTGAATATGAACTACACCTCTAAAAATTTTCTTTTTT |
Internal bar code: | TGGCGAGACACTCGAAGGGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 126 |
LEAP-Seq percent confirming: | 10.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCCTGCCTTTAAGGTCTGC |
Suggested primer 2: | ATGGGTTACCTGGGACTCGA |