| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.074147 |
| Chromosome: | chromosome 9 |
| Location: | 951572 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g402750 | COG2 | Component of oligomeric golgi complex; (1 of 1) PTHR12961//PTHR12961:SF0 - CONSERVED OLIGOMERIC GOLGI COMPLEX COMPONENT 2 // CONSERVED OLIGOMERIC GOLGI COMPLEX SUBUNIT 2 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGACTACATAGTGCAACATGTCACGACTTTTGTCTGTCGCTGCTGCTG |
| Internal bar code: | ACCTGTTTATGGGTTTACCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1583 |
| LEAP-Seq percent confirming: | 4.54545 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCGAACTGGTGCATATGC |
| Suggested primer 2: | AATAGCTCGTCCGGCTTAGC |