Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.074160 |
Chromosome: | chromosome 1 |
Location: | 4176947 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g027950 | IFT74,CMG1,IFT71,IFT72 | (1 of 1) PTHR31432:SF0 - INTRAFLAGELLAR TRANSPORT PROTEIN 74 HOMOLOG; Intraflagellar transport protein 74/72 | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGATGTGCCCGCCCCCGGCCCCTCGCCTACCTGCAGTCTTCTCCCACT |
Internal bar code: | GTCAATCGAGCGGGGTAGCAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2101 |
LEAP-Seq percent confirming: | 87.0968 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGTTGTGTCAGTGGTTGC |
Suggested primer 2: | GTCAAGAAGGCCGTGGTGTA |