Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.074166 |
Chromosome: | chromosome 6 |
Location: | 8356568 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g307600 | (1 of 1) K11290 - template-activating factor I (SET, TAF1, I2PP2A); Nucleosome assembly protein | 3'UTR | |
Cre06.g307650 | (1 of 1) PF12138 - Spherulation-specific family 4 (Spherulin4) | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGCCGAGACCCCCGCCGTCCCTTCAACGGAGGCCGCGTCACAGCTTC |
Internal bar code: | CGTACCAATCTGGCATGTTTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1640 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 49 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCGAGTGATGGCTCATACC |
Suggested primer 2: | AAATGTAGGCACGAAGGGCA |