| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.074182 |
| Chromosome: | chromosome 16 |
| Location: | 4012695 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689950 | (1 of 1) PF00168//PF08372 - C2 domain (C2) // Plant phosphoribosyltransferase C-terminal (PRT_C) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGGCCCCGGCGCTGGAGGGTCTCTTTCTCTTTCACTGTACAACACAC |
| Internal bar code: | GTTAAATTACACCCATTCGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 629 |
| LEAP-Seq percent confirming: | 93.3333 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTTGAACTCGGCCACAGT |
| Suggested primer 2: | GTAGCGGTAGGTGCGACTAC |