| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.074185 |
| Chromosome: | chromosome 12 |
| Location: | 4534871 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g521200 | RFC1 | (1 of 1) K10754 - replication factor C subunit 1 (RFC1); DNA replication factor C complex subunit 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATTATTCCGTCCATGCACGGTCAGAACCCCCATCACACACAGACACTT |
| Internal bar code: | TGATCGCCGCTGGTTTCATTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 784 |
| LEAP-Seq percent confirming: | 12.1212 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACTGGACGGGTGTTCATG |
| Suggested primer 2: | ACCTCGAAGCTGACCAAGTG |