| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.074199 |
| Chromosome: | chromosome 17 |
| Location: | 1958308 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g710150 | RPT4,NSG8 | 26S proteasome regulatory subunit; (1 of 1) K03064 - 26S proteasome regulatory subunit T4 (PSMC6, RPT4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCACCATCCTGCTCGCAACGCTGCACGCTTCCTCGGCTGCACGCTTC |
| Internal bar code: | CAGGTGTTCTGAGCTACCCACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 566 |
| LEAP-Seq percent confirming: | 57.1429 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACGTGTATCGCCTTGGTT |
| Suggested primer 2: | CACACCTGTTTGTGGCCATG |