| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.074207 |
| Chromosome: | chromosome 3 |
| Location: | 7512303 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g205400 | (1 of 1) PF01344//PF07707 - Kelch motif (Kelch_1) // BTB And C-terminal Kelch (BACK) | 3'UTR | |
| lncRNA_TCONS_00115950 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAAACCGCACACAGCGCCAGGCCCGATCGCCCACACATCAGCGGCGCC |
| Internal bar code: | TTGTGCTCGGAATTCGTGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 149 |
| LEAP-Seq percent confirming: | 56.25 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCATTGAAGCCCATTCCCT |
| Suggested primer 2: | TGGATCCTTCAGCTGCCTTG |