Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.074226 |
Chromosome: | chromosome 3 |
Location: | 6796999 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g197100 | LRL1 | Lipid remodeling regulator 1; (1 of 2) PTHR10641:SF585 - MYB DNA-BINDING-LIKE PROTEIN | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACACAAACTCCGACCGATATGCATACGCTCACAAACAACTTGCGCACGC |
Internal bar code: | CAGGACTCCCGTAAAACCCCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5182 |
LEAP-Seq percent confirming: | 82.7586 |
LEAP-Seq n confirming: | 48 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACTACCGCTTAGACGACCG |
Suggested primer 2: | GCTCTCGTCCTCTCTTACGC |