Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.074242 |
Chromosome: | chromosome 4 |
Location: | 1779574 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g800462 | (1 of 1) IPR020996 - Type III secretion system, AvrPto | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGTAACAGGCGCCCTCATGCGCTATTAAACTAACGTGTGTCCGCATCA |
Internal bar code: | GAAGAGTCCGGAATCGTCTGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1307 |
LEAP-Seq percent confirming: | 24.1379 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTACCCTCAACCCAAGGTCG |
Suggested primer 2: | GGAGGTGCAGTCGGTGTTAA |