Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.074279 |
Chromosome: | chromosome 6 |
Location: | 8442467 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g308400 | PTN1 | (1 of 1) 3.1.3.16//3.1.3.48//3.1.3.67 - Protein-serine/threonine phosphatase / Serine/threonine specific protein phosphatase // Protein-tyrosine-phosphatase / PTPase // Phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase / Phosphatidylinositol-3,4,5-trisphosphate 3-phosphohydrolase; PTEN PI-3 phosphatase | 3'UTR |
Cre06.g308450 | RAF1 | (1 of 1) PTHR35299//PTHR35299:SF2 - FAMILY NOT NAMED // RUBISCO ACCUMULATION FACTOR 1, CHLOROPLASTIC-RELATED; RuBisCO accumulation factor 1 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGCGCCAGTCACCAGCGAATTGGGGTGCGCGGGCCTCTTCACATGCAT |
Internal bar code: | TGCGAATACGGCTCAGCGGTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2337 |
LEAP-Seq percent confirming: | 96.9697 |
LEAP-Seq n confirming: | 32 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGGTGCAGCAAGACTTTG |
Suggested primer 2: | ATCTCCTGAGGGTCCATGCT |