| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.074293 |
| Chromosome: | plastome |
| Location: | 136472 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802320 | chlN,2716986,ChreCp056 | light-independent protochlorophyllide reductase subunit N; (1 of 1) K04038 - light-independent protochlorophyllide reductase subunit N (chlN) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGATAATTTATTAGAAATTTCTTTAGCACGTTTTTTAACACGTTGTG |
| Internal bar code: | GCACAGGCTATTCCTATGTAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 591 |
| LEAP-Seq percent confirming: | 9.09091 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCAGACCACACAAACCAT |
| Suggested primer 2: | CCCATTGTTGTAGCACGTGC |