| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.074453 |
| Chromosome: | chromosome 2 |
| Location: | 6107256 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g119600 | PSD1 | Phosphatidylserine decarboxylase; (1 of 1) 4.1.1.65 - Phosphatidylserine decarboxylase / PS decarboxylase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCCGGAGCTCGGGCTTGAGCCGGCGCGCGAAGAAGGCCTGCAGGGTG |
| Internal bar code: | CTCGAATCTGGAGCTAGGGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 313 |
| LEAP-Seq percent confirming: | 53.8462 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCCCCTACCATCGTACGC |
| Suggested primer 2: | GAACCCCATCACACCTCCAG |