| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.074461 |
| Chromosome: | chromosome 7 |
| Location: | 2749184 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g331300 | AGP3 | ADP-glucose pyrophosphorylase large subunit; (1 of 1) PF00132//PF00483 - Bacterial transferase hexapeptide (six repeats) (Hexapep) // Nucleotidyl transferase (NTP_transferase) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACCTGCTGGTGCCTCCTCTTGAGGCTGCGCGCTGCCATATCAAAGGC |
| Internal bar code: | CTACCGGGAAGGGGCGCGAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 163 |
| LEAP-Seq percent confirming: | 46.1538 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGGTATGACCCCACCACC |
| Suggested primer 2: | CTGTTGCGGCAATCAACACA |