Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.074473 |
Chromosome: | chromosome 15 |
Location: | 2235398 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g142607 | SENP2 | {"ULP2-type SUMO protease; (1 of 7) PF02902 - Ulp1 protease family, C-terminal catalytic domain (Peptidase_C48) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCTGCTCTGAGTGCTGCTCTGAGTGCTGCTGCACGTGCTGCTGCGAGT |
Internal bar code: | GGGACGTCCGCTAACGAGATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 658 |
LEAP-Seq percent confirming: | 1.6129 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 61 |
LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGCCAGCTTATTCCCCTG |
Suggested primer 2: | AGCTCTGTGGTGAAGACGTG |