| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.074520 |
| Chromosome: | plastome |
| Location: | 31329 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802279 | rps8,2716952 | 30S ribosomal protein S8; (1 of 1) PTHR11758//PTHR11758:SF17 - 40S RIBOSOMAL PROTEIN S15A // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGATTTATTTCTAATTTTTCTAAAGTTACCAATTGAGTTAAAAAAAGCT |
| Internal bar code: | TAAGGTTAGTCTAGGGTAGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 197 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCGCACGCCCATTTTTCAA |
| Suggested primer 2: | AAGAGGCACTGTTACGGCAA |