| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.074547 |
| Chromosome: | chromosome 12 |
| Location: | 9170969 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g543350 | FDH2,GSNOR2,FDH1 | (1 of 2) 1.1.1.1//1.1.1.284 - Alcohol dehydrogenase / Aldehyde reductase // S-(hydroxymethyl)glutathione dehydrogenase / NAD-linked formaldehyde dehydrogenase; Nitrosoglutathione (GSNO) reductase 2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCCAAGGAGTTTGGTGCCACCGACTGCATCAACCCCAAGGACCACGA |
| Internal bar code: | CGGTTCGCCTTTTGGACAACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3688 |
| LEAP-Seq percent confirming: | 36.8421 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCTACCCCGTTATGTAGC |
| Suggested primer 2: | GCTTTCACAGGCAAGTGGTG |