Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.074590 |
Chromosome: | chromosome 16 |
Location: | 2272205 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g658650 | MYO1 | (1 of 1) PTHR13140//PTHR13140:SF256//PTHR13140:SF304 - MYOSIN // MYOSIN-14-RELATED // MYOSIN IA HEAVY CHAIN-RELATED; Myosin heavy chain, class XI | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCGGGCCGTCGGCCCTGCCCCTGCGGTTCTCCACACGCTGACCATGC |
Internal bar code: | CTGTCTTGTCTAAGTCCGGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2041 |
LEAP-Seq percent confirming: | 95.2381 |
LEAP-Seq n confirming: | 40 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGTGAATGCGCCTGTATG |
Suggested primer 2: | TTCATACCCCATGCCCCAAC |