| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.074628 |
| Chromosome: | chromosome 2 |
| Location: | 7160371 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g390356 | (1 of 1) PTHR22849//PTHR22849:SF0 - WDSAM1 PROTEIN // WD REPEAT, SAM AND U-BOX DOMAIN-CONTAINING PROTEIN 1 | intron | |
| Cre09.g390393 | (1 of 5) PF01713 - Smr domain (Smr) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCTGCGCACAATAGACCGTGTACATGACTGGGTGGTGTGCCGTTGTGG |
| Internal bar code: | TATTTCAGGTGTCTTGCTGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4146 |
| LEAP-Seq percent confirming: | 83.871 |
| LEAP-Seq n confirming: | 52 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGCACAAACGGAAGCACT |
| Suggested primer 2: | CTGGTTTGCCTATTTCCGCG |