Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.074647 |
Chromosome: | chromosome 9 |
Location: | 6391712 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g414650 | (1 of 18) K08824 - cyclin-dependent kinase-like [EC:2.7.11.22] (CDKL) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGACGGCGCTCGGCGCTTCTAGATCAATCCCGCGACAACACCTGTCACA |
Internal bar code: | GTGGAGAATATATTACCGCCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 6165 |
LEAP-Seq percent confirming: | 96.5909 |
LEAP-Seq n confirming: | 85 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 88 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAACCATATGGCGCCGAAAC |
Suggested primer 2: | TCTCGATACCAACTACGCGC |