| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.074737 |
| Chromosome: | chromosome 7 |
| Location: | 2352258 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g328250 | Pumilio-family RNA binding protein; (1 of 2) K17943 - pumilio RNA-binding family (PUM) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGGCGCGCCACCCCTACGGCTGCCGACTGGTGCAGTCGCTGCTGCAG |
| Internal bar code: | TTGACGGTTTAGGTTGTATACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 103 |
| LEAP-Seq percent confirming: | 13.3333 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCAGATGCAAGGGGTATGT |
| Suggested primer 2: | GCCCACGATACTGTTCCCAA |