Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.074757 |
Chromosome: | chromosome 9 |
Location: | 2159490 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g395650 | (1 of 2) PF13806 - Rieske-like [2Fe-2S] domain (Rieske_2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACACCCTCCCGACCAGCAGCCAACTCGCACCCTGTACCCGCGAGCTGT |
Internal bar code: | ATTCAGTTTGGTTAGGCCACCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3567 |
LEAP-Seq percent confirming: | 5.88235 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTGTTCGCCTATTTCGTG |
Suggested primer 2: | CGCAAGGATGTTTGTGTGCA |