| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.074766 |
| Chromosome: | chromosome 10 |
| Location: | 4724325 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g452450 | TIC110 | Chloroplast envelope protein; (1 of 1) PF16940 - Chloroplast envelope transporter (Tic110) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGCAACAAACCAAAACGCGCACACGAGTTATGTTTTCCCGCTGTTGTC |
| Internal bar code: | GGGGATAATCCTTTAGGGCATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 107 |
| LEAP-Seq percent confirming: | 37.5 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACACCCATCCCCTCCTCTG |
| Suggested primer 2: | TTTGCTGTGCGCTGTAACAC |