| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.074784 |
| Chromosome: | plastome |
| Location: | 8266 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802265 | ChreCp003,2716966,chlB | (1 of 1) K04039 - light-independent protochlorophyllide reductase subunit B (chlB); light-independent protochlorophyllide reductase subunit B | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTTATTTTAGCTGATGTAAACCATTATCGTGTAAATGAATTACAAGCT |
| Internal bar code: | CTCCCGGGTGGGCTAGGAGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 238 |
| LEAP-Seq percent confirming: | 8.33333 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 88 |
| LEAP-Seq n unique pos: | 96 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAAAACCAGGCTGCTTGG |
| Suggested primer 2: | CCCGCTCATATCGGTGTGTT |