| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.074824 |
| Chromosome: | chromosome 4 |
| Location: | 2050810 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g219250 | IFT52,BLD1 | Intraflagellar transport protein 52; (1 of 1) PF09822 - ABC-type uncharacterized transport system (ABC_transp_aux) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGGTGAACGATGGATTATGGATATCGGAGTGCACAGAGGCTGACAAG |
| Internal bar code: | TAATCAGAAAAGAGGGCATTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1600 |
| LEAP-Seq percent confirming: | 30.2326 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTTCCAGTCGAGTGTTGCC |
| Suggested primer 2: | GCATCGCGCAGTACAAGATG |