| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.074857 |
| Chromosome: | chromosome 4 |
| Location: | 3059441 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g225250 | (1 of 3) PF14494 - Domain of unknown function (DUF4436) (DUF4436) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACCGAGCCCGGCACGCACCTACGCGGTCGCCCTGGGACAGAGTCACC |
| Internal bar code: | TGGCAGAGTGGTGAGTGACCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 679 |
| LEAP-Seq percent confirming: | 31.5789 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTCCCACACATCCCTATC |
| Suggested primer 2: | ATGCGTGTGAATATGCGTGC |