Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.074858 |
Chromosome: | chromosome 11 |
Location: | 1538416 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g468550 | ATPVG,ATPVG1 | Vacuolar ATP synthase subunit G; (1 of 1) K02152 - V-type H+-transporting ATPase subunit G (ATPeV1G, ATP6G) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTGGGGGAGGGACTACTGGTTCCAAAGGTGCAGCAGGGAAGGCCATT |
Internal bar code: | GGTAGCGACTACTGGGTGCTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 147 |
LEAP-Seq percent confirming: | 5.55556 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCGCCTCTATGTCCTCCTT |
Suggested primer 2: | CCCCATAGTCGTCTGCATCC |