Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.074873 |
Chromosome: | chromosome 2 |
Location: | 6560171 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g389250 | AOF1 | (1 of 2) 1.5.3.17 - Non-specific polyamine oxidase / Polyamine oxidase; Amine oxidase, flavin-containing | 5'UTR |
Cre09.g389300 | ODA7B | (1 of 2) PTHR24365:SF315 - DYNEIN ASSEMBLY FACTOR 1, AXONEMAL; Outer row dynein assembly protein 7 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTATGTGAAACGTAGCGCGACCTAGTGACGCGACCGCTCGCTTTGCTTG |
Internal bar code: | TACGTCAGGAAGGTGAAATTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1366 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 29 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTAGAGCGTGTGTTGTGG |
Suggested primer 2: | GCAATCGCATTCTGCTCCAG |