| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.074883 |
| Chromosome: | chromosome 6 |
| Location: | 5372398 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g285300 | SUT1 | Sugar transporter; (1 of 1) K08200 - MFS transporter, OCT family, solute carrier family 22 (organic cation transporter), member 3 (SLC22A3, OCT3) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCGCAAAACATGTAGTCTCGAACCACGTCCGCAAGCAGAACAGCTTG |
| Internal bar code: | AAGGGAGGATTGTGTATCTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6204 |
| LEAP-Seq percent confirming: | 69.5652 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCTCGGGATTTGGAACTG |
| Suggested primer 2: | AGCCAAATACGGGAAGGGTG |