Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.074942 |
Chromosome: | chromosome 16 |
Location: | 6177855 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676900 | UAA5 | UDP-galactose transporter; (1 of 2) K15276 - solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2 (SLC35B2, PAPST1) | 3'UTR |
Cre16.g677001 | (1 of 1) PTHR31596:SF1 - T-CELL ACTIVATION INHIBITOR, MITOCHONDRIAL | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAAGCCATCGGAACCCACCTTTTGCCACCAAGCCGCTACACGGTACCAA |
Internal bar code: | GCGTCAACTATACTTGTCTGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1792 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTTAGCAGCCATAACCCGG |
Suggested primer 2: | CACCAAATGCGGACATCGTC |