| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.074967 |
| Chromosome: | plastome |
| Location: | 28210 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802277 | 2717058,rpl14,ChreCp015 | 50S ribosomal protein L14; (1 of 1) PTHR11761//PTHR11761:SF13 - 50S/60S RIBOSOMAL PROTEIN L14/L23 // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGAAGGAGGCAGTTGCCTGCCAACTGCCTCCTTCGGAGTATTAAAAT |
| Internal bar code: | TAGGTAATGACGAAAAGCTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 250 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTTGTACCAGGCAACCCT |
| Suggested primer 2: | TGCAAAGCATATCCCCCGAA |