Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.074970 |
Chromosome: | chromosome 10 |
Location: | 588948 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g801104 | (1 of 1) IPR000104//IPR003072//IPR004333 - Antifreeze protein, type I // Orphan nuclear receptor, NOR1 type // Transcription factor, SBP-box | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCTGCTGCTGCCGCCGCTGCTGCTACTGCTGCTCTGTCCGACCTTGGC |
Internal bar code: | ACTTACACCATCTGGAGGGGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 132 |
LEAP-Seq percent confirming: | 53.3333 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCATACAACATCGGCGTTC |
Suggested primer 2: | ACTACTGCAGCACCATGTCC |