| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.075012 |
| Chromosome: | chromosome 2 |
| Location: | 5333259 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g113300 | OPR6 | OctotricoPeptide Repeat protein 6; (1 of 19) PTHR21228//PTHR21228:SF20 - FAST LEU-RICH DOMAIN-CONTAINING // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCATATAGAGCCCCACTCACACCCTACGGTATGTCCTCGACCTCCATGT |
| Internal bar code: | GGGCCCAGGCGATATAACCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 112 |
| LEAP-Seq percent confirming: | 11.1111 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCAGTCCCAAGTACGGAG |
| Suggested primer 2: | ACCTAGAGCAGCTGGATGGA |