| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.075027 |
| Chromosome: | chromosome 3 |
| Location: | 5489264 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g184600 | RWP7 | (1 of 1) IPR003035//IPR009057 - RWP-RK domain // Homeodomain-like; RWP-RK transcription factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCTACAAACAACAAGGGGAACAGGCAGATGCAATGCGCGTCCTTGGAA |
| Internal bar code: | TGGCGTTTACGAGCAGTCGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4170 |
| LEAP-Seq percent confirming: | 83.7209 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCCCCAAAGTTGCAGTC |
| Suggested primer 2: | CTGGCCCGAATACGCATTTG |