| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.075037 |
| Chromosome: | chromosome 5 |
| Location: | 1517836 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234659 | MRPL30,uL30m | (1 of 1) K02907 - large subunit ribosomal protein L30 (RP-L30, MRPL30, rpmD); Mitochondrial ribosomal protein L30 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATGCATGTCGTGCTGGCGTGCCCGCGACGCCAAGCCTCTTTGCCTGCT |
| Internal bar code: | TTAGTCAGAAATTTGGGGGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 185 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTTGTGTCGATCTCCCCA |
| Suggested primer 2: | GAACTGACAGGACACGCAGA |