| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.075061 |
| Chromosome: | chromosome 6 |
| Location: | 8446675 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g308450 | RAF1 | (1 of 1) PTHR35299//PTHR35299:SF2 - FAMILY NOT NAMED // RUBISCO ACCUMULATION FACTOR 1, CHLOROPLASTIC-RELATED; RuBisCO accumulation factor 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCAAGTGGCGGCCGAGCCACCTTCTTCTGAAACCACAGAGCTGATGAG |
| Internal bar code: | TGGGCAAATCAGATGTACGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3093 |
| LEAP-Seq percent confirming: | 87.4126 |
| LEAP-Seq n confirming: | 125 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 143 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCATCCTCCAGCACTAGA |
| Suggested primer 2: | GCTTCTAGGCGTGTGACACA |