| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.075081 |
| Chromosome: | chromosome 10 |
| Location: | 4412877 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g450400 | NUOE,NUO5 | (1 of 1) K03943 - NADH dehydrogenase (ubiquinone) flavoprotein 2 (NDUFV2); NADH:ubiquinone oxidoreductase 24 kDa subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCCAGCCGAGGCCTGCACGATCGTGCAGTCCCCCCCTCCCCCCTTGGC |
| Internal bar code: | TTCTGATGCGCCCAAAAGGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3772 |
| LEAP-Seq percent confirming: | 99.0291 |
| LEAP-Seq n confirming: | 102 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 103 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGGTATGTGTGAGGAGCT |
| Suggested primer 2: | TCGAACTGGTCTGGCTTGTC |