| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.075083 |
| Chromosome: | chromosome 11 |
| Location: | 4192069 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g481500 | HIS7 | Imidazole glycerol phosphate synthase; (1 of 1) K01663 - glutamine amidotransferase / cyclase (HIS7) | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGCTAACAGTTCAATTTTTAGGACTTTACAAGATGCAGTCCCTATCTG |
| Internal bar code: | ATCGGAATGCGATGATTTGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 314 |
| LEAP-Seq percent confirming: | 11.6279 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 76 |
| LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTTTGCAGGTGTGTGGAG |
| Suggested primer 2: | GATAACAGCGCTGGCAAAGG |