Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.075118 |
Chromosome: | chromosome 6 |
Location: | 7330582 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g299650 | CLPR6 | (1 of 3) PTHR10381//PTHR10381:SF24 - ATP-DEPENDENT CLP PROTEASE PROTEOLYTIC SUBUNIT // SUBFAMILY NOT NAMED; inactive subunit of chloroplast ClpP complex | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAGATAGTAAGCGCCTGACTTATTGCGATGCTTGCCTAGACCATCGGTG |
Internal bar code: | GCGCTACCGCGGCTGCATGTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2561 |
LEAP-Seq percent confirming: | 59.375 |
LEAP-Seq n confirming: | 19 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGCCGCCGATGAAGATGA |
Suggested primer 2: | GAGCAGAGGTACTTGGGCAG |