| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.075123 |
| Chromosome: | chromosome 2 |
| Location: | 2105050 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g089100 | COPD1 | (1 of 1) PTHR10121 - COATOMER SUBUNIT DELTA; Delta subunit of COP-I complex | outside_mRNA |
| Cre02.g089150 | (1 of 1) K11314 - transcriptional adapter 2-alpha (TADA2A, ADA2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCTGAGTCCTGACTGCAAAACGGGAAGCTGCGGGCGGAACGCCAATGC |
| Internal bar code: | AACGTTAACATTGTCCCACCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1948 |
| LEAP-Seq percent confirming: | 95.5224 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACACACACATGCACCAGG |
| Suggested primer 2: | CTCCTTCTTCCGGTTGGACC |