| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.075152 |
| Chromosome: | chromosome 12 |
| Location: | 1081233 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g491500 | UBA2,UBA3,UBC1 | RUB1/NEDD8 E1 activating enzyme; (1 of 1) K10686 - ubiquitin-activating enzyme E1 C (UBE1C, UBA3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAACTACGTCATTGTCGCGGTCGCTCAAGTGACCCCTCTCCCCACCCC |
| Internal bar code: | GTGGGCGACCCTGATAATACTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 364 |
| LEAP-Seq percent confirming: | 11.7647 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACGGCAGTACGGACCTGTA |
| Suggested primer 2: | GATGAAGGAGGCGTAGGTCG |