| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.075160 |
| Chromosome: | chromosome 2 |
| Location: | 3576375 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g099500 | CVL1 | Fe2+/Mn2+ transporter, VIT1/CCC1 family; (1 of 2) PF01988 - VIT family (VIT1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTGGCGACGGATGAGAGCCTCACAGATGCCCTCCGTCGACCGGACCGG |
| Internal bar code: | TAGATGTCTTTAGAGATCCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3711 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 324 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 324 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCGAATCTGACACAGGGT |
| Suggested primer 2: | CCTTCTCGCCACCTTCTTGT |