| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.075168 |
| Chromosome: | chromosome 3 |
| Location: | 6400270 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g192750 | (1 of 4) 2.7.11.13 - Protein kinase C / PKC | 3'UTR | |
| Cre03.g800361 | (1 of 1) IPR001584//IPR001878//IPR001986//IPR012337//IPR013103//IPR025724 - Integrase, catalytic core // Zinc finger, CCHC-type // Enolpyruvate transferase domain // Ribonuclease H-like domain // Reverse transcriptase, RNA-dependent DNA polymerase // GAG-pre-integrase domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAATGCGCGTGTGTAGTTATCAGCAACACGCTTGGTCGGGTCTTAAGTC |
| Internal bar code: | AGGCGTTGCGGAGGAAGCTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2236 |
| LEAP-Seq percent confirming: | 9.09091 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGACTTCAGACGGTGCTCA |
| Suggested primer 2: | AAGGAACGTGTATGGCTGGG |