Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.075249 |
Chromosome: | chromosome 1 |
Location: | 6048995 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g042700 | (1 of 140) IPR002048 - EF-hand domain | 5'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGGTCTTGTTGCCGGAGGCCGCGGCTGCTCGCCCTCAGAGCTGCAAAA |
Internal bar code: | AGACCCAGGTGGGTGTAACGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4284 |
LEAP-Seq percent confirming: | 96.0 |
LEAP-Seq n confirming: | 72 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 75 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATGCGATGAGGCTTGCTTG |
Suggested primer 2: | ACTTGAAGAGCCCTCCATGC |