| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.075268 |
| Chromosome: | chromosome 16 |
| Location: | 2545215 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g660800 | TIM44 | (1 of 1) K17804 - mitochondrial import inner membrane translocase subunit TIM44 (TIM44); Mitochondrial inner membrane translocase subunit | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTTTTATTGTCCGTTCAGTCCATCACTGCTGATTCAGGGGCACCCCTG |
| Internal bar code: | GCGCCGAGCCGACGCGGGGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2054 |
| LEAP-Seq percent confirming: | 93.75 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACATGATGTGGCAGTCCA |
| Suggested primer 2: | AACACATGAACGCGTTTGGG |