| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.075305 |
| Chromosome: | plastome |
| Location: | 102233 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802308 | ChreCp044,2716995,psbL | photosystem II reaction center subunit XII; (1 of 1) K02713 - photosystem II PsbL protein (psbL) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAACATAAATATAAATGTTATCCCCTTCCCCTTTGGGTAAATAAATTTT |
| Internal bar code: | ATCGTCAATGTTTACGGTTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 153 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCCGAAGAGACTACCAACA |
| Suggested primer 2: | GCGGCTGTGGCTGTAGATAT |